NameNeuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6

Inheritance

Autosomal dominant

Description

Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss¹. Stroke-like episodes may occur in over one third of patients and can be misdiagnosed as recurrent ischemic stroke^2,3. Often presents with gastrointestinal symptoms, including chronic refractory nausea, which preceded neurologic manifestations by decades in one documented case⁴. Renal involvement has been reported and may occasionally precede neurological symptoms^5,6,7. Peripheral neuropathy has been reported in NOTCH2NLC-related NIID⁸, where expansions account for ~1-5.5% of genetically undiagnosed inherited peripheral neuropathy cases, typically motor-dominant⁹. Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.

Prevalence

400 patients reported in literature¹⁰. Found in individuals of East Asian ancestry¹¹.

Age of Onset

Typical: 30-70¹²; Range: 7¹³- 78¹⁴.

HPO Terms

HP:0000020 Urinary incontinence HP:0000600 Abnormality of the pharynx HP:0000602 Ophthalmoplegia HP:0000616 Miosis HP:0000639 Nystagmus HP:0000648 Optic atrophy HP:0000708 Atypical behavior HP:0000726 Dementia HP:0001250 Seizure HP:0001251 Ataxia HP:0001260 Dysarthria HP:0001265 Hyporeflexia HP:0001276 Hypertonia HP:0001279 Syncope HP:0001288 Gait disturbance HP:0001324 Muscle weakness HP:0001337 Tremor HP:0001347 Hyperreflexia HP:0002063 Rigidity HP:0002119 Ventriculomegaly HP:0002167 Abnormal speech pattern HP:0002352 Leukoencephalopathy HP:0002353 EEG abnormality HP:0002572 Episodic vomiting HP:0002650 Scoliosis HP:0002922 Increased CSF protein concentration HP:0003298 Spina bifida occulta HP:0003312 Abnormal vertebral body morphology HP:0003403 EMG: decremental response of compound muscle action potential to repetitive nerve stimulation HP:0003431 Decreased motor nerve conduction velocity HP:0003448 Decreased sensory nerve conduction velocity HP:0003457 EMG abnormality HP:0003474 Somatic sensory dysfunction HP:0007185 Loss of consciousness HP:0012229 CSF pleocytosis HP:0020068 Intranuclear inclusion bodies HP:0100022 Abnormality of movement HP:0100543 Cognitive impairment

Association

Mendelian

Locus

hg19chr1:145209323-145209354

hg38chr1:149390802-149390842

t2tchr1:148519695-148519738

Details

Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats¹⁵. Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype^16,17: NOTCH2NLC expansions have been linked to Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders¹⁸. Age of onset inversely related to allele size¹⁹. Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype²⁰. Interruptions documented: GGA, GGG²¹; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed²². Detection may be challenging due to paralogy between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19.

Mechanism

GoF

Polyglycine expansion; may relate to methylation or RNA pathogenicity^12,23,22. Proposed mechanisms include toxic uN2CpolyG/polyglycine aggregation, RNA pathogenicity, impaired autophagy, mitochondrial dysfunction, and innate immune activation⁶. The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy²⁴. Tau pathology is evident; changes in p-tau levels and tau deposition have been reported²⁵. Expanded polyG proteins also induce nucleolar stress through interaction with NPM1 and rRNA. This disrupts ribosomal homeostasis and alters 3D chromatin organization through reduced CTCF/RAD21 expression²⁶. Aggregates of a second polyglycine protein translated from NOTCH2NLC variant 2 are present in the majority of p62-positive intranuclear inclusions in patient skin and skeletal muscle and co-localize with uN2CpolyG²⁷.

Detection

Short-read sequencing is reported to be unreliable for sizing of large or complex expansions²⁸. RP-PCR has screened for expansions^10,29, while long-read sequencing has resolved size, structure, and methylation³⁰.

Year

2019³¹

Location in Gene

5' UTR

Gene Strand

Alleles

Ref. Motif

CGG

Ranges

Benign (ref.)

–

Benign (gene)

–

Pathogenic (ref.)

CGG

Pathogen. (gene)

CGG

Unknown (ref.)

–

Unknown (gene)

–

Interruption (ref.)

AGG, CAG

Interrup. (gene)

AGG, CAG

gnomAD

Pathogenic genotype frequency data is not displayed for this locus because a substantial number of large alleles failed manual review by the gnomAD team.

References

Direct supporting references for info on this page.

Ontology Lookup Service (OLS)

mondo:0011327

Clinical features of

Yun,Tian, Lu,Zhou, Jing,Gao, Bin,Jiao, Sizhe,Zhang, Qiao,Xiao, Jin,Xue, Ying,Wang, Hui,Liang, Yaling,Liu, Guang,Ji, Chenhui,Mao, Caiyan,Liu, Liling,Dong, Long,Zhang, Shugang,Zhang, Jiping,Yi, Guohua,Zhao, Yingying,Luo, Qiying,Sun, Yafang,Zhou, Fang,Yi, Xiaoyu,Chen, Chaojun,Zhou, Nina,Xie, Mengchuan,Luo, Lingyan,Yao, Yacen,Hu, Mengqi,Zhang, Qiuming,Zeng, Liangjuan,Fang, Hong-Yu,Long, Yuanyuan,Xie, Ling,Weng, Si,Chen, Juan,Du, Qian,Xu, Li,Feng, Qing,Huang, Xuan,Hou, Junpu,Wang, Bin,Xie, Lin,Zhou, Lili,Long, Ji-Feng,Guo, Junling,Wang, Xinxiang,Yan, Hong,Jiang, Hongwei,Xu, Ranhui,Duan, Beisha,Tang, Lu,Shen

Journal of neurology, neurosurgery, and psychiatry · 2022-09-23

pmid:36150844

Neuronal intranuclear inclusion disease in patients with adult-onset non-vascular leukoencephalopathy.

Yi Hong,Liu, Ying Tsen,Chou, Fu Pang,Chang, Wei Ju,Lee, Yuh Cherng,Guo, Cheng Ta,Chou, Hui Chun,Huang, Takeshi,Mizuguchi, Chien Chen,Chou, Hsiang Yu,Yu, Kai Wei,Yu, Hsiu Mei,Wu, Pei Chien,Tsai, Naomichi,Matsumoto, Yi Chung,Lee, Yi Chu,Liao

Brain : a journal of neurology · 2022-09-14

pmid:35411397

Neuronal intranuclear inclusion disease with initial manifestation of intractable nausea and vomiting responsive to corticosteroids: a case report.

Long,Luo, Ling,Zhu, Yong,Liang, Ying,Yuan, Lei,Chen, Weiwen,Peng, Gao,Yang, Ronghe,Yang

Frontiers in immunology · 2026-03-18

pmid:41929501

High burden of kidney involvement in neuronal intranuclear inclusion disease.

Zhenxian,Hu, Hongfei,Tai, An,Wang, Yi,Zhou, Hua,Pan, Zaiqiang,Zhang

Frontiers in neurology · 2026-08-11

pmid:42643490

Immunological characterization of neuronal intranuclear inclusion disease with kidney injury: an exploratory analysis in a multi-center cohort.

Ying,Ji, Xiaowen,Li, Jin,Tian, Xian,Chen, Guang,Ji, Maofeng,Shi, Jing,Zhang, Man,Xia, Qianru,An, Xiang,Li, Liangyu,Li, Wenjing,Song, Ruixue,Zhang, Lei,Bao, Yuqiao,Wang, Yingying,Cui, Yuyao,Tian, Hao,Chen

Frontiers in immunology · 2026-04-14

pmid:42058219

Adult-Onset Neuronal Intranuclear Inclusion Disease Initially Manifesting as Bladder Dysfunction: A Case Report.

Anna,Yamaki, Hirofumi,Sekino, Satoshi,Kawana, Ryo,Yamakuni, Shiro,Ishii, Hiroshi,Ito

Cureus · 2026-03-19

pmid:42005169

Subclinical peripheral nerve demyelination without overt symptoms in a family with neuronal intranuclear inclusion disease harboring biallelic repeat expansions.

Hang,Zhang, Taiqi,Zhao, Honglin,Zheng, Suying,Duan, Chenyang,Liu, Yaochong,Zhang, Qiang,Li, Han,Liu, Haiyang,Luo, Yuming,Xu

BMC neurology · 2026-04-18

pmid:42001002

Non-coding repeat expansions within NOTCH2NLC and RFC1 genes contribute to unsolved inherited peripheral neuropathies.

Xin-Yun,Zhang, Hao,Yu, Gong-Lu,Liu, Zhi-Ying,Wu, Hai-Lin,Dong

Journal of human genetics · 2026-09-10

pmid:42716992

Heterogenous Genetic, Clinical, and Imaging Features in Patients with Neuronal Intranuclear Inclusion Disease Carrying

Yusran Ady,Fitrah, Yo,Higuchi, Norikazu,Hara, Takayoshi,Tokutake, Masato,Kanazawa, Kazuhiro,Sanpei, Tomone,Taneda, Akihiko,Nakajima, Shin,Koide, Shintaro,Tsuboguchi, Midori,Watanabe, Junki,Fukumoto, Shoichiro,Ando, Tomoe,Sato, Yohei,Iwafuchi, Aki,Sato, Hideki,Hayashi, Takanobu,Ishiguro, Hayato,Takeda, Toshiaki,Takahashi, Nobuyoshi,Fukuhara, Kensaku,Kasuga, Akinori,Miyashita, Osamu,Onodera, Takeshi,Ikeuchi

Brain sciences · 2023-06-15

pmid:37371433

Neurological disorders caused by novel non-coding repeat expansions: clinical features and differential diagnosis.

Elisa,Vegezzi, Hiroyuki,Ishiura, D Cristopher,Bragg, David,Pellerin, Francesca,Magrinelli, Riccardo,Currò, Stefano,Facchini, Arianna,Tucci, John,Hardy, Nutan,Sharma, Matt C,Danzi, Stephan,Zuchner, Bernard,Brais, Mary M,Reilly, Shoji,Tsuji, Henry,Houlden, Andrea,Cortese

The Lancet. Neurology · 2024-07-01

pmid:38876750

12omim:603472

Clinical phenotypic diversity of

Masahiro,Ando, Yujiro,Higuchi, Jun-Hui,Yuan, Akiko,Yoshimura, Mika,Dozono, Takahiro,Hobara, Fumikazu,Kojima, Yutaka,Noguchi, Mika,Takeuchi, Jun,Takei, Yu,Hiramatsu, Satoshi,Nozuma, Tomonori,Nakamura, Yusuke,Sakiyama, Akihiro,Hashiguchi, Eiji,Matsuura, Yuji,Okamoto, Jun,Sone, Hiroshi,Takashima

Journal of neurology, neurosurgery, and psychiatry · 2023-03-22

pmid:36948577

Rapidly progressive adult-onset neuronal intranuclear inclusion disease beginning with autonomic symptoms: a case report.

Yi,Zhu, Qian,Yang, Yun,Tian, Weibing,Fan, Xinfa,Mao

Frontiers in neurology · 2023-05-25

pmid:37305750

Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions

Stephanie E.,Wallace, Lora JH,Bean

GeneReviews® [Internet] · 2022-10-20

genereviews:NBK535148

Erratum: Prevalence and Characterization of

Neurology. Genetics · 2024-07-12

pmid:39055960

Familial adult-onset neuronal intranuclear inclusion disease: A case report and literature review.

Lijun,Wei, Jiaqi,Wang, Changming,Xu, Tengchao,Yang, Yun,Tian, Lu,Shen

Medicine · 2024-11-01

pmid:39496005

Expansion of Human-Specific GGC Repeat in Neuronal Intranuclear Inclusion Disease-Related Disorders.

Yun,Tian, Jun-Ling,Wang, Wen,Huang, Sheng,Zeng, Bin,Jiao, Zhen,Liu, Zhao,Chen, Yujing,Li, Ying,Wang, Hao-Xuan,Min, Xue-Jing,Wang, Yong,You, Ru-Xu,Zhang, Xiao-Yu,Chen, Fang,Yi, Ya-Fang,Zhou, Hong-Yu,Long, Chao-Jun,Zhou, Xuan,Hou, Jun-Pu,Wang, Bin,Xie, Fan,Liang, Zhuan-Yi,Yang, Qi-Ying,Sun, Emily G,Allen, Andrew Mark,Shafik, Ha Eun,Kong, Ji-Feng,Guo, Xin-Xiang,Yan, Zheng-Mao,Hu, Kun,Xia, Hong,Jiang, Hong-Wei,Xu, Ran-Hui,Duan, Peng,Jin, Bei-Sha,Tang, Lu,Shen

American journal of human genetics · 2019-06-06

pmid:31178126

Neuronal Intranuclear Inclusion Disease with NOTCH2NLC GGC Repeat Expansion: A Systematic Review and Challenges of Phenotypic Characterization.

Tian,Zeng, Yiqun,Chen, Honghao,Huang, Shengqi,Li, Jiaqi,Huang, Haobo,Xie, Shenyi,Lin, Siyao,Chen, Guangyong,Chen, Dehao,Yang

Aging and disease · 2024-01-31

pmid:38377026

The Phenotypes and Mechanisms of NOTCH2NLC-Related GGC Repeat Expansion Disorders: a Comprehensive Review.

Xiu-Rong,Huang, Bei-Sha,Tang, Peng,Jin, Ji-Feng,Guo

Molecular neurobiology · 2021-10-31

pmid:34718964

Comprehensive genetic diagnosis of tandem repeat expansion disorders with programmable targeted nanopore sequencing.

Igor,Stevanovski, Sanjog R,Chintalaphani, Hasindu,Gamaarachchi, James M,Ferguson, Sandy S,Pineda, Carolin K,Scriba, Michel,Tchan, Victor,Fung, Karl,Ng, Andrea,Cortese, Henry,Houlden, Carol,Dobson-Stone, Lauren,Fitzpatrick, Glenda,Halliday, Gianina,Ravenscroft, Mark R,Davis, Nigel G,Laing, Avi,Fellner, Marina,Kennerson, Kishore R,Kumar, Ira W,Deveson

Science advances · 2022-03-04

pmid:35245110

Sequence composition changes in short tandem repeats: heterogeneity, detection, mechanisms and clinical implications.

Indhu-Shree,Rajan-Babu, Egor,Dolzhenko, Michael A,Eberle, Jan M,Friedman

Nature reviews. Genetics · 2024-03-11

pmid:38467784

Clinical and neuroimaging review of triplet repeat diseases.

Ryo,Kurokawa, Mariko,Kurokawa, Akihiko,Mitsutake, Moto,Nakaya, Akira,Baba, Yasuhiro,Nakata, Toshio,Moritani, Osamu,Abe

Japanese journal of radiology · 2022-09-28

pmid:36169768

uN2CpolyG-mediated p65 nuclear sequestration suppresses the NF-κB-NLRP3 pathway in neuronal intranuclear inclusion disease.

Yu,Shen, Kaiyan,Jiang, Dandan,Tan, Min,Zhu, Yusen,Qiu, Pencheng,Huang, Wenquan,Zou, Jianwen,Deng, Zhaoxia,Wang, Ying,Xiong, Daojun,Hong

Cell communication and signaling : CCS · 2025-02-07

pmid:39920690

Plasma p-tau species are elevated in presymptomatic and symptomatic neuronal intranuclear inclusion disease.

Sizhe,Zhang, Bin,Jiao, Yan,Zeng, Qiying,Sun, Xiaoyu,Chen, Weiwei,Zhang, Ziyu,Ouyang, Qiao,Xiao, Lu,Zhou, Yunni,Li, Ling,Weng, Juan,Du, Qian,Xu, Yang,Yang, Mengqi,Zhang, Qiuming,Zeng, Liangjuan,Fang, Hongyu,Long, Yuanyuan,Xie, Si,Chen, Li,Feng, Qing,Huang, Lili,Long, Yafang,Zhou, Fang,Yi, Yacen,Hu, Qiong,Liu, Yongcheng,Pan, Lin,Zhou, Yulai,Li, Shuo,Hu, Jifeng,Guo, Junling,Wang, Hong,Jiang, Hongwei,Xu, Ranhui,Duan, Beisha,Tang, Yun,Tian, Lu,Shen

EBioMedicine · 2026-01-14

pmid:41539185

ASO therapy rescues NOTCH2NLC GGC repeat expansion-induced genomic damage, 3D chromatin structural abnormalities, and senescence.

Mengjie,Li, Mibo,Tang, Xiaoyan,Hao, Zhengwei,Hu, Dongrui,Ma, Shuangjie,Li, Chunyan,Zuo, Zhiyun,Wang, Yuanyuan,Liang, Yanmei,Feng, Chenwei,Hao, Chen,Wang, Huanyu,Li, Yalan,Yang, Yuemeng,Sun, Shasha,Qi, Chengyuan,Mao, Yuming,Xu, Qun,Wang, De,Yang, Ruwei,Yang, Ziyao,Zhou, Peilin,Ji, Song,Tan, Zaiqiang,Zhang, Hao,Chen, Albert R,La Spada, Changhe,Shi

Nature communications · 2026-04-07

pmid:41942455

A Second Pathogenic Protein, PolyGN2C-iso2, Reveals a Dual-Protein Pathology in Neuronal Intranuclear Inclusion Disease.

Kang,Zhang, Wenhao,Ma, Yi,Zhou, Zhijie,Wu, Pan,Gao, Hongze,Niu, Hongfei,Tai, Tianyi,Zhao, Zheyue,Dong, Li,Li, Yan,Zhang, An,Wang, Si,Shen, Yueyang,Li, Sifei,Yu, Yan,Peng, Wang,Sheng, Xiaoyan,Dong, Hua,Pan, Kaibin,Shi, Magdalena J,Koziol, Xiaobing,Wu, Zaiqiang,Zhang

Advanced science (Weinheim, Baden-Wurttemberg, Germany) · 2026-07-23

pmid:42489345

An update on the neurological short tandem repeat expansion disorders and the emergence of long-read sequencing diagnostics.

Sanjog R,Chintalaphani, Sandy S,Pineda, Ira W,Deveson, Kishore R,Kumar

Acta neuropathologica communications · 2021-05-25

pmid:34034831

Saliva-Based Triple-Primed PCR as a Non-Invasive Tool for Detecting NOTCH2NLC GGC Repeat Expansions in NIID.

Yangye,Lian, Shaoping,Zhong, Jingzhen,Liang, Yuzhe,Li, Xing,Chen, Xin,Wang, Jing,Ding

Clinical laboratory · 2026-07-01

pmid:42411677

Father-to-offspring transmission of extremely long NOTCH2NLC repeat expansions with contractions: genetic and epigenetic profiling with long-read sequencing.

Hiromi,Fukuda, Daisuke,Yamaguchi, Kristofor,Nyquist, Yasushi,Yabuki, Satoko,Miyatake, Yuri,Uchiyama, Kohei,Hamanaka, Ken,Saida, Eriko,Koshimizu, Naomi,Tsuchida, Atsushi,Fujita, Satomi,Mitsuhashi, Kazuyuki,Ohbo, Yuki,Satake, Jun,Sone, Hiroshi,Doi, Keisuke,Morihara, Tomoko,Okamoto, Yuji,Takahashi, Aaron M,Wenger, Norifumi,Shioda, Fumiaki,Tanaka, Naomichi,Matsumoto, Takeshi,Mizuguchi

Clinical epigenetics · 2021-11-13

pmid:34774111

Noncoding CGG repeat expansions in neuronal intranuclear inclusion disease, oculopharyngodistal myopathy and an overlapping disease.

Hiroyuki,Ishiura, Shota,Shibata, Jun,Yoshimura, Yuta,Suzuki, Wei,Qu, Koichiro,Doi, M Asem,Almansour, Junko Kanda,Kikuchi, Makiko,Taira, Jun,Mitsui, Yuji,Takahashi, Yaeko,Ichikawa, Tatsuo,Mano, Atsushi,Iwata, Yasuo,Harigaya, Miho Kawabe,Matsukawa, Takashi,Matsukawa, Masaki,Tanaka, Yuichiro,Shirota, Ryo,Ohtomo, Hisatomo,Kowa, Hidetoshi,Date, Aki,Mitsue, Hiroyuki,Hatsuta, Satoru,Morimoto, Shigeo,Murayama, Yasushi,Shiio, Yuko,Saito, Akihiko,Mitsutake, Mizuho,Kawai, Takuya,Sasaki, Yusuke,Sugiyama, Masashi,Hamada, Gaku,Ohtomo, Yasuo,Terao, Yoshihiko,Nakazato, Akitoshi,Takeda, Yoshio,Sakiyama, Yumi,Umeda-Kameyama, Jun,Shinmi, Katsuhisa,Ogata, Yutaka,Kohno, Shen-Yang,Lim, Ai Huey,Tan, Jun,Shimizu, Jun,Goto, Ichizo,Nishino, Tatsushi,Toda, Shinichi,Morishita, Shoji,Tsuji

Nature genetics · 2019-07-22

pmid:31332380

Additional Literature

Additional literature related to this locus.

Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem repeats, and disease, in medline format)

Non-coding repeat expansions within NOTCH2NLC and RFC1 genes contribute to unsolved inherited peripheral neuropathies.

Xin-Yun,Zhang, Hao,Yu, Gong-Lu,Liu, Zhi-Ying,Wu, Hai-Lin,Dong

Journal of human genetics · 2026-09-10

pmid:42716992

Sequestration of CAPNS1 into Polyglycine Aggregates in a Cellular Model of NOTCH2NLC Repeat Expansion.

Arisa,Kubokawa, Ai,Ohki, Risa,Ono, Makoto,Araki, Motoaki,Yanaizu, Yoshihiro,Kino

Biological & pharmaceutical bulletin · 2026-01-01

pmid:42686620

Optimized Cas9-Enriched Nanopore Sequencing and Analysis Workflow for Clinical Diagnosis of Repeat Expansion Disorders.

Seungbok,Lee, Chanju,Jung, Minjeong,Kim, Narae,Kim, Gue-Ho,Hwang, Soon-Tae,Lee, Kon,Chu, Sang Kun,Lee, Han-Joon,Kim, Jong-Hee,Chae, Sangsu,Bae, Jangsup,Moon

Advanced science (Weinheim, Baden-Wurttemberg, Germany) · 2026-08-29

pmid:42667167

High burden of kidney involvement in neuronal intranuclear inclusion disease.

Zhenxian,Hu, Hongfei,Tai, An,Wang, Yi,Zhou, Hua,Pan, Zaiqiang,Zhang

Frontiers in neurology · 2026-08-11

pmid:42643490

Novel proteomics and neuropathology of

Feixia,Zhan, Jiaxin,Zhu, Yang,Wang, Yuwen,Cao, Xiya,Shen, Wenlu,Lv, Jiewei,Wei, Xiaojun,Huang, Steven X,Hou, Xinghua,Luan, Li,Cao

Frontiers in aging neuroscience · 2026-07-03

pmid:42490784

PolyG Fibrils Coalesce Into Nuclear Ribbons That Engage Proteostasis Machinery in Neuronal Intranuclear Inclusion Disease.

Hui,Dong, Yongcheng,Pan, Zhiyao,Tang, Yuxuan,Yao, Guicong,Zhang, Junpu,Wang, Haonan,Xiao, Yun,Tian, Beisha,Tang, Dan,Li, Qiang,Guo, Ruijun,Tian, Qiong,Liu, Cong,Liu

Advanced science (Weinheim, Baden-Wurttemberg, Germany) · 2026-07-20

pmid:42474087

Evolutionary implications of

Si,Shen, Hong-Fei,Tai, Songtao,Niu, Hua,Pan, Xingao,Wang, Bin,Chen, Yuzhi,Shi, Hengheng,Wang, Shan,Lv, Yaou,Liu, Zaiqiang,Zhang

Brain communications · 2026-06-03

pmid:42396598

Case Report: Neuronal intranuclear inclusion disease mimicking recurrent stroke in the setting of intracranial stenosis.

Jingmin,Zhao, Guangxun,Shen, Lumei,Chi

Frontiers in medicine · 2026-05-20

pmid:42245955

Re-evaluating archival specimens as a pathologic diagnostic resource for neuronal intranuclear inclusion disease.

Yangye,Lian, Shaoping,Zhong, Jingzhen,Liang, Ke,Xu, Xin,Wang, Yuan,Ji, Jing,Ding

American journal of clinical pathology · 2026-05-05

pmid:42177789

Locus NIID NOTCH2NLC

Disease

Locus

Alleles

gnomAD

References

Additional Literature